Design multiplex PCR primer and probe gen ORF1ab and gen N on COVID-19

Hasna Mirda Amazan; Andani Eka Putra; Rauza Sukma Rita

doi:10.18203/2394-6040.ijcmph20231261

Authors

Hasna Mirda Amazan Master Program in Biomedical Sciences, Faculty of Medicine, Andalas University, Padang, Indonesia
Andani Eka Putra Department of Microbiology, Faculty of Medicine, Andalas University, Padang, Indonesia
Rauza Sukma Rita Department of Biochemistry, Faculty of Medicine, Andalas University, Padang, Indonesia

DOI:

https://doi.org/10.18203/2394-6040.ijcmph20231261

Keywords:

COVID-19, Primary and Probe, ORF1ab gene, N Gene

Abstract

Background: Coronavirus disease 2019 (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus which is a new strain of the Coronavirus, the primary and probe designs were carried out to find candidate primers and probes to be used as the detection of COVID-19. The purpose of this study was to design multiplex PCR on primers and ORF1ab and N gene probes in COVID-19 examination using the multiplex PCR method and it is expected to have good validity in the examination.

Methods: The research design is in the form of explorative descriptive with a cross sectional approach. Starting from April to December 2021. The samples used in this study were 221 COVID-19 gene sequences downloaded from the NCBI and GISAID gene databases.

Results: The design results of the ORF1ab gene primer and probe with forward primer: 5'- CGCAATTTACAACACAGAC -3' reverse primer: 5'- GTTCTTTATGCTAGCCACT -3' amplicon length 183 bp, and probe sequence: FAM 5'-AAACACACAACAGCATCGTCA-3' BHQ-1, on the N gene with forward primer: 5'-AATTCAACTCCAGGCAG -3' and reverse primer: 5'- CTCTCTCAAGCTGGTTCAATC -3' amplicon length 111 bp, and probe sequence: HEX 5'-CAGCAAAGCAAGAGCAGCA-3' BHQ-1 primary pair sequence and ORF1ab gene probe and N gene conjecture qualified for q-PCR.

Conclusions: The obtained primary and probe pair sequences can be used as COVID-19 detection using the multiplex PCR method.

Metrics

Metrics Loading ...

References

Li Geng, M Peng, Y Meng, L Lu. Molecular immune pathogenesis and diagnosis of Covid-19. J Pharmaceutical Analysis. 2020;10(2):102-8.

Huang CY, Xingwang W, Lili L, Jianping L, Yi ZH. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. The Lancet. 2019;395(10223):78-9.

Khailany RA, Safdar M, Ozaslan M. Genomic characterization of a novel SARS-CoV-2. Gene Rep. 2020;19:100682.

Wang W, Xu Y, Gao R, Lu R, Han K, Wu G, Tan W. Detection of SARS-CoV-2 in different types of clinical specimens. JAMA. 2020;323(18):1843-4.

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: a tool to design target-specific primers for a polymerase chain reaction. BMC Bioinformatics. 2012;13(134):56-9.

Gennaro F, Pizzol D, Marotta C, Antunes M, Racalbuto V, Veronese N, et al. Coronavirus diseases (COVID-19) current status and future perspectives: A narrative review. Int J Environ Res Public Health. 2020;17(8):76-9.

Wölfel R, Corman VM, Guggemos W, Seilmaier M, Zange S, Müller MA, Wendtner C. Virological assessment of hospitalized patients with COVID-2019. Nature. 2020;581(7809):465-9.

Holshue ML, DeBolt C, Lindquist S, Lofy KH, Wiesman J, Bruce H, Pillai SK. The first case of the 2019 novel coronavirus in the United States. New England J Med. 2020;8:45-8.

Widowati EW. Primary Design of Cytochrome B (Cyt b) As One of the PCR (Polymerase Chain Reaction) Components for Pig DNA Detection. Lab. Individu Research. 2013: 1-64.

Debode F, Marien A, Janssen É, Bragard C, Berben G. The influence of amplicon length on real-time PCR results Frédéric. 2017;21(1):3-11.

Holm WV, Ghesquière J, Boon N, Verspecht T, Bernaerts K, Zayed N. A viability quantitative pcr dilemma: are longer amplicons better? Applied Environmental Microbiology. 2019;87(5):1-11.

Hung J, Weng Z. Designing polymerase chain reaction primers using primer plus. Cold Spring Harbor Laboratory Press. 2016;7:821-6.

Dewi DA, Wardhana AH, Ekawasti F, Sawitri DH. Comparison of five sets of primers for detecting Trypanosoma evansi in mice using the Polymerase Chain Reaction (PCR) In Prosiding National Seminar on Animal Husbandry and Veterinary Technology. 2022;9:178-88.

Saraswati H, Seprianto S, Wahyuni FW. Desain Primer Secara In Silico untuk Amplifikasi Gen cryIII dari Bacillus thuringiensis Isolat Lokal. Indonesian Journal of Biotechnology and Biodiversity. 2019;3(1):33-8.

Popp J, Bauer M. Modern Techniques for Pathogen Detection. 2015;3:60-2.

Bishop JL, Campbell SA, Farrell P, Fitzgerald M, Haugen M, Kocmond W. Designing real-time assays on the smart cycler II system, Cepheid. 2017;8:45-8.